{
  "kind": "card",
  "schema_version": 1,
  "id": "01M4FWEJKF124DH5VAZVYVM98P",
  "dna": "aagagagatcgagcctcgggtttgtttcgtggagccaccgaaacggacactttactcaggcgtt",
  "number": "SYS-016",
  "world": "SYS",
  "world_id": "0A8RP9A2FQY6DX743S4XASFYP8",
  "family": "sys-systeemkaarten",
  "type": "knowledge",
  "lang": "en",
  "title": "Checkout",
  "name": "Checkout",
  "lede": "The buyer's stack: five Jumbocards that carry a purchase from the card to the confirmation, in the look of the card's own World. Price and promise come from the signed manifest; the live status and the payment come from the router.",
  "summary": "The buyer's stack: five Jumbocards that carry a purchase from the card to the confirmation, in the look of the card's own World. Price and promise come from the signed manifest; the live status and the payment come from the router.",
  "seo_title": "Checkout — Systeem",
  "content": {
    "body_markdown": "De kopersstack is een systeemkaart in de World SYS (canon koopfunctie-in-de-kaart,\n9 okt 2026). Wie op een tradingcard op \"Bestellen\" klikt, komt hier: vijf Jumbocards —\nhet aanbod, aantal en levering, jouw gegevens, controle en betalen, bevestiging — in de\nhuid van de World van dat artikel. De stappen en hun werking zijn van het systeem en\noveral gelijk; het uiterlijk is van de World.\n\nWat de verkoper belooft (prijs, verzendkosten, levertijd) komt uit het ondertekende\nmanifest. De status van een uniek stuk, de reservering en de betaling komen uit de\nrouter; zonder antwoord van de router kan er niet besteld worden. De betaling staat\ningebed in de vierde kaart; alleen bij iDEAL ga je even naar je bank. De bon is een vel\nover de kaart van het artikel, achter een geheime link uit de bevestigingsmail."
  },
  "codon": "red-stone-key",
  "tier": "basic",
  "edition": "Edition 1",
  "relations": [
    {
      "type": "topic",
      "id": "tp:systems"
    }
  ],
  "representations": {
    "html": "https://eoena.com/checkout/",
    "markdown": "https://eoena.com/checkout/card.md",
    "machine_index": "https://eoena.com/llms.txt"
  },
  "canonical": "https://eoena.com/checkout/",
  "catalog": "https://catalog.tumblecard.com/aagagagatcgagcctcgggtttgtttcgtggagccaccgaaacggacactttactcaggcgtt/",
  "verify": "https://eoena.com/verify/?dna=aagagagatcgagcctcgggtttgtttcgtggagccaccgaaacggacactttactcaggcgtt&v=c84981d6",
  "actions": [
    {
      "type": "open",
      "target": "https://eoena.com/checkout/"
    },
    {
      "type": "verify",
      "target": "https://eoena.com/verify/?dna=aagagagatcgagcctcgggtttgtttcgtggagccaccgaaacggacactttactcaggcgtt&v=c84981d6"
    }
  ],
  "created_at": "2026-10-09T08:36:15.020Z",
  "updated_at": "2026-10-09T08:36:15.020Z",
  "content_hash": "6c94e8403bb1a86c5539b78bf83d797a5c6b00e53ac4b3076700c6a275d56baa",
  "content_version": "c84981d6"
}