• Home
Eo EnaEo Ena
Index Download Compass Back
Tumble Cards EOE-002
Tumble Cards
The medium

Every card is made to outlive this website — and turns with a click.

Edition 1 The Eo Ena Almanac Turn ↻
Index Download Compass Back
Tumble Cards EOE-002

No menu, no tree. The almanac is dissolved into loose cards that wander and connect.

Card · The atom. One thing with its own DNA and its own number: verifiable, made to outlive this website — on paper, in a QR, on any domain.
World · Where a card comes from. Its language, colour, type and mark.
Family · Cards that grow together inside a world. Never finished.
Set · A bounded edition. Complete when every card is there.
Stack · Cards in an order that carries meaning: a lesson, a recipe, a route.
Deck · A free selection for one purpose. No order of its own.
Palm·Key·Rust
Integrity check Download
dna:tttgattagctcatgatgaggatacagaagtctgagacgtaaacgcttgatctgacatccaata
Edition 1 The Eo Ena Almanac Turn ↻

How does this work?

No website and no menu: everything here is a card — one thing, readable at a glance, independent enough to stand on its own.

Cards belong to a world and grow in families; stacks give them order. What you are looking at is one of them.

Reading the card
NumberTop right, permanent. A number is never reused and never moves to another card.
TurnClick or swipe. The front shows, the back explains — a card has no other sides.
MenuThe three lines, top left: back, turn, the index of this world, and the printable worksheet.
DNAThe sequence in the footer. It identifies a card, even away from this screen.
Every card stands on its own. Take one to the workbench and the rest can stay where they are.
Eo Ena Almanac
© 2026 · All rights reserved.