# Worlds — Eo Ena

## Card

- **Number:** EOE-003
- **Name:** Worlds
- **World:** EOE
- **Type:** knowledge
- **Language:** en
- **ULID:** 01KY6Y2D8D699MHVA2400RM3YV
- **DNA:** atagccatcagatgtccaagagaaaaacgaggaatttcgtaaacgcttgatctgacatccaatc
- **Version:** 221994f5 (2026-09-17)
- **Verify:** https://eoena.com/verify/?dna=atagccatcagatgtccaagagaaaaacgaggaatttcgtaaacgcttgatctgacatccaatc&v=221994f5

## Front

*Where cards come from*

A world is where a card comes from — its origin, not its place.

## Back

- **lead:** Every world has a name, a face and a boundary. What a world carries:
- **items:** [{"term":"Identity","def":"name, code and maker."},{"term":"Face","def":"its own colour, type and mark. The construction stays shared."},{"term":"Language","def":"one tongue per world; the card's chrome follows it."},{"term":"Families and Sets","def":"inside a world, families grow; sets are complete."},{"term":"Boundaries","def":"origin is fixed on the card; placement is free."},{"term":"Life","def":"editions and years."}]

## Body

What a world is: where a card comes from, in six facets.

## Relations

- tp:systems: topic
- [Eo Ena](https://eoena.com/): world
- [image](https://eoena.com/eoena-collections-atagccatcagatgtccaagagaaaaacgaggaatttcgtaaacgcttgatctgacatccaatc/assets/cards/eoe-hero-collections.webp): card illustration

## Source

- **Canonical:** https://eoena.com/eoena-collections-atagccatcagatgtccaagagaaaaacgaggaatttcgtaaacgcttgatctgacatccaatc/

The canonical HTML page and card.json are the authoritative representations.