# Eo Ena

## Card

- **Number:** EOE-001
- **Name:** Eo Ena
- **World:** EOE
- **Type:** knowledge
- **Language:** en
- **ULID:** 01KY6Y2D8BN2AP46PQKSDHAK3J
- **DNA:** gggagccccgagacggtcctgctgccgtaccccatactagaaacgcttgatctgacatccaagt
- **Version:** 604e5c08 (2026-09-17)
- **Verify:** https://eoena.com/verify/?dna=gggagccccgagacggtcctgctgccgtaccccatactagaaacgcttgatctgacatccaagt&v=604e5c08

## Front

*Curator & Narrator*

I bring together what is scattered.
So you can make, understand,
and pass on.

## Back

- **credo:** I keep what lasts.
- **lead:** Eo Ena is the narrator of the almanac. She gathers what lies scattered across the worlds and guides you through — so you can make, understand, and pass on.
- **note_label:** The name
- **note:** Eo is Latin for 'I go, I travel'. She is the one who sets out and brings back what proves worth the journey.

## Body

Eo Ena introduces herself: the curator and narrator of the almanac.

## Relations

- tp:systems: topic
- [Eo Ena](https://eoena.com/): world
- [image](https://eoena.com/eoena-gggagccccgagacggtcctgctgccgtaccccatactagaaacgcttgatctgacatccaagt/assets/cards/eoe-hero-eoena.webp): card illustration

## Source

- **Canonical:** https://eoena.com/eoena-gggagccccgagacggtcctgctgccgtaccccatactagaaacgcttgatctgacatccaagt/

The canonical HTML page and card.json are the authoritative representations.