# The Index — Eo Ena

## Card

- **Number:** EOE-004
- **Name:** The Index
- **World:** EOE
- **Type:** knowledge
- **Language:** en
- **ULID:** 01KY6Y2D8EHBSQRST5XFDXFT79
- **DNA:** gaggttatcttacgctcacctggttcgttccttggatggcaaacgcttgatctgacatccaatg
- **Version:** a21f4b26 (2026-09-17)
- **Verify:** https://eoena.com/verify/?dna=gaggttatcttacgctcacctggttcgttccttggatggcaaacgcttgatctgacatccaatg&v=a21f4b26

## Front

*One sheet per world*

Every card, by name and by DNA — the full list across all worlds.

## Back

- **lead:** The Index keeps every card, across all worlds — findable long after this website.
- **items:** [{"term":"By name and DNA","def":"the codon name to remember, the full DNA as an anchor that stays."},{"term":"All worlds","def":"one index across all worlds — one sheet each, not bound to any site."},{"term":"Growing","def":"the Index is a Stack of sheets; every sheet is a card with its own number, and new sheets are minted as a world fills."},{"term":"Verify","def":"any card, on any domain it lives on: identity, version and signature."}]
- **cta:** {"card":"01KJCPKDHEVRGP5WTRP0Z35AB6","label":"Open the Index","note":"A stack of sheets — one per world, growing with the almanac."}

## Body

The register of the almanac: every card findable by name and by DNA.

## Relations

- tp:systems: topic
- [Eo Ena](https://eoena.com/): world
- [image](https://eoena.com/eoena-index-gaggttatcttacgctcacctggttcgttccttggatggcaaacgcttgatctgacatccaatg/assets/cards/eoe-hero-index.webp): card illustration

## Source

- **Canonical:** https://eoena.com/eoena-index-gaggttatcttacgctcacctggttcgttccttggatggcaaacgcttgatctgacatccaatg/

The canonical HTML page and card.json are the authoritative representations.