# Eozoe — Systeem

## Card

- **Number:** SYS-015
- **Name:** Eozoe
- **World:** SYS
- **Type:** knowledge
- **Language:** en
- **ULID:** 1B2MH5FGX2RNJE5NMNFPDPWKCA
- **DNA:** tacccgcatgagtccggccccttcgcgtcgtgcatcgaggaggtacccagagcccttaatggag
- **Version:** 95279d3a (2026-08-26)
- **Verify:** https://eoena.com/verify/?dna=tacccgcatgagtccggccccttcgcgtcgtgcatcgaggaggtacccagagcccttaatggag&v=95279d3a

## Front

The Eozoe sheet of the Index — the permanent identity and official entrance of a world whose windows and snapshots may keep changing.

## Body

Een zelfstandig blad uit de Stack **Index**. Het draagt de permanente identiteit
van de externe World Eozoe. De veranderlijke vensters en snapshots binnen Eozoe
krijgen daardoor niet ten onrechte telkens een nieuwe World-identiteit.

## Relations

- [Index](https://eoena.com/stacks/index/stack.md): stack
- tp:systems: topic
- [Systeem](https://eoena.com/card-index-tctgagaccgagttatccgagtaaattgataggggccgcgaaacgctagcgccggcgtcgagtg/): world

## Source

- **Canonical:** https://eoena.com/index-eozoe-tacccgcatgagtccggccccttcgcgtcgtgcatcgaggaggtacccagagcccttaatggag/

The canonical HTML page and card.json are the authoritative representations.