# Systeem

## Card

- **Number:** SYS-007
- **Name:** Systeem
- **World:** SYS
- **Type:** knowledge
- **Language:** en
- **ULID:** 01KZ8DK9KEVKQYTZM2J0AWK4Q2
- **DNA:** tctatgtttgtccttggaaggcaaaccctagcgcagtgagaaacgctttcaatcgcggcgcgtg
- **Version:** f72f0fa7 (2026-08-22)
- **Verify:** https://eoena.com/verify/?dna=tctatgtttgtccttggaaggcaaaccctagcgcagtgagaaacgctttcaatcgcggcgcgtg&v=f72f0fa7

## Front

The system sheet of the Index — the worldless system cards of the almanac, by codon name, title and number.

## Body

Een zelfstandig blad uit de Stack **Index**: het draagt de wereld Systeem —
elke kaart bij codon-naam, titel en nummer. De omslag is de Card Index (SYS-003);
de stapel toont alle bladen onder elkaar.

## Relations

- [Index](https://eoena.com/stacks/index/stack.md): stack
- tp:systems: topic
- [Systeem](https://eoena.com/card-index-tctgagaccgagttatccgagtaaattgataggggccgcgaaacgctagcgccggcgtcgagtg/): world

## Source

- **Canonical:** https://eoena.com/index-systeem-tctatgtttgtccttggaaggcaaaccctagcgcagtgagaaacgctttcaatcgcggcgcgtg/

The canonical HTML page and card.json are the authoritative representations.