• Home
Eo EnaEo Ena
Index Download Compass Back
Worlds EOE-003
Worlds
Where cards come from

A world is where a card comes from — its origin, not its place.

Edition 1 The Eo Ena Almanac Turn ↻
Index Download Compass Back
Worlds EOE-003

Every world has a name, a face and a boundary. What a world carries:

Identity · name, code and maker.
Face · its own colour, type and mark. The construction stays shared.
Language · one tongue per world; the card's chrome follows it.
Families and Sets · inside a world, families grow; sets are complete.
Boundaries · origin is fixed on the card; placement is free.
Life · editions and years.
Oak·Owl·Tin
Integrity check Download
dna:atagccatcagatgtccaagagaaaaacgaggaatttcgtaaacgcttgatctgacatccaatc
Edition 1 The Eo Ena Almanac Turn ↻

How does this work?

No website and no menu: everything here is a card — one thing, readable at a glance, independent enough to stand on its own.

Cards belong to a world and grow in families; stacks give them order. What you are looking at is one of them.

Reading the card
NumberTop right, permanent. A number is never reused and never moves to another card.
TurnClick or swipe. The front shows, the back explains — a card has no other sides.
MenuThe three lines, top left: back, turn, the index of this world, and the printable worksheet.
DNAThe sequence in the footer. It identifies a card, even away from this screen.
Every card stands on its own. Take one to the workbench and the rest can stay where they are.
Eo Ena Almanac
© 2026 · All rights reserved.