• Home
Eo EnaEo Ena
Index Download Compass Back
Eo Ena EOE-001
Eo Ena
Curator & Narrator

I bring together what is scattered.
So you can make, understand,
and pass on.

Edition 1 The Eo Ena Almanac Turn ↻
Index Download Compass Back
Eo Ena EOE-001
I keep what lasts.

Eo Ena is the narrator of the almanac. She gathers what lies scattered across the worlds and guides you through — so you can make, understand, and pass on.

The nameEo is Latin for 'I go, I travel'. She is the one who sets out and brings back what proves worth the journey.

Fog·Plum·Crow
Integrity check Download
dna:gggagccccgagacggtcctgctgccgtaccccatactagaaacgcttgatctgacatccaagt
Edition 1 The Eo Ena Almanac Turn ↻

How does this work?

No website and no menu: everything here is a card — one thing, readable at a glance, independent enough to stand on its own.

Cards belong to a world and grow in families; stacks give them order. What you are looking at is one of them.

Reading the card
NumberTop right, permanent. A number is never reused and never moves to another card.
TurnClick or swipe. The front shows, the back explains — a card has no other sides.
MenuThe three lines, top left: back, turn, the index of this world, and the printable worksheet.
DNAThe sequence in the footer. It identifies a card, even away from this screen.
Every card stands on its own. Take one to the workbench and the rest can stay where they are.
Eo Ena Almanac
© 2026 · All rights reserved.