• Home
Eo EnaEo Ena
Index Download Compass Back
The Index EOE-004
The IndexSTACK
One sheet per world

Every card, by name and by DNA — the full list across all worlds.

Edition 1 The Eo Ena Almanac Turn ↻
Index Download Compass Back
The Index EOE-004

The Index keeps every card, across all worlds — findable long after this website.

By name and DNA · the codon name to remember, the full DNA as an anchor that stays.
All worlds · one index across all worlds — one sheet each, not bound to any site.
Growing · the Index is a Stack of sheets; every sheet is a card with its own number, and new sheets are minted as a world fills.
Verify · any card, on any domain it lives on: identity, version and signature.
Open the Index →A stack of sheets — one per world, growing with the almanac.
Green·Bone·Tin
Integrity check Download
dna:gaggttatcttacgctcacctggttcgttccttggatggcaaacgcttgatctgacatccaatg
Edition 1 The Eo Ena Almanac Turn ↻

How does this work?

No website and no menu: everything here is a card — one thing, readable at a glance, independent enough to stand on its own.

Cards belong to a world and grow in families; stacks give them order. What you are looking at is one of them.

Reading the card
NumberTop right, permanent. A number is never reused and never moves to another card.
TurnClick or swipe. The front shows, the back explains — a card has no other sides.
MenuThe three lines, top left: back, turn, the index of this world, and the printable worksheet.
DNAThe sequence in the footer. It identifies a card, even away from this screen.
Every card stands on its own. Take one to the workbench and the rest can stay where they are.
Eo Ena Almanac
© 2026 · All rights reserved.